Skip to content

Commit

Permalink
new Qiagen kits
Browse files Browse the repository at this point in the history
  • Loading branch information
mizraelson committed Sep 26, 2024
1 parent 1582589 commit f70b842
Show file tree
Hide file tree
Showing 2 changed files with 45 additions and 0 deletions.
1 change: 1 addition & 0 deletions changelogs/v4.7.1.md
Original file line number Diff line number Diff line change
Expand Up @@ -6,3 +6,4 @@
## 📚 New Presets

- Added preset `bruker-human-sc-xcr-vdj-beacon` for TCR/BCR analyses of Bruker Beacon data
- Added presets for new Qiagen kits: `qiagen-human-rna-tcr-umi-targeted-qiaseq` and `qiagen-mouse-rna-tcr-umi-targeted-qiaseq`
44 changes: 44 additions & 0 deletions src/main/resources/presets/protocols/qiaseq.yaml
Original file line number Diff line number Diff line change
Expand Up @@ -75,3 +75,47 @@
^N{:4}gacacaaaggtatgtcccagtcttatggagatt(R1:*) |
^N{:4}ggaaaatagtaggcttgggagaaaagtctgagtc(R1:*) |
^N{:4}cacctctttagggtagaaatctttcaccagacaag(R1:*) \ ^(UMI:N{12})N{12}(R2:*)
"qiagen-human-rna-tcr-umi-targeted-qiaseq":
vendor: "QIAGEN"
label: "QIAseq Targeted RNA Panel Human TCR"
category: non-generic
inheritFrom: generic-amplicon-with-umi
pipeline:
- align
- refineTagsAndSort
- assemble
- exportClones
mixins:
- type: SetSpecies
species: hsa
- type: MaterialTypeRNA
- type: LeftAlignmentBoundaryNoPoint
floating: false
- type: RightAlignmentBoundaryNoPoint
floating: true
geneType: C
- type: SetClonotypeAssemblingFeatures
features: CDR3
- type: AddQcChecks
args:
- type: OverlappedReadsLessBetter
middle: 0.05
upper: 0.1
- type: SetTagPattern
tagPattern: ^(R1:*) \ ^(UMI:N{14:18})atgcattggagtcct
align:
inheritFrom: generic-amplicon-with-umi
overrides:
parameters:
readsLayout: ReverseOnly

"qiagen-mouse-rna-tcr-umi-targeted-qiaseq":
vendor: "QIAGEN"
label: "QIAseq Targeted RNA Panel Mouse TCR"
category: non-generic
inheritFrom: qiagen-human-rna-tcr-umi-targeted-qiaseq
mixins:
- type: SetSpecies
species: mmu

0 comments on commit f70b842

Please sign in to comment.