You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
I am working on a pipeline that calls variants using Mutect2 and uses those mutations for somatic variant calling in other samples. To achieve this I'm using the -allele flag in Mutect2 to pass the desired positions to genotype to Mutect2. However it appears that Mutect2 will output variants that it then is unable to parse as an -allele file. I believe this is because the REF column is too long.
Steps to reproduce
Try to variant call using an -allele VCF containing this line:
5 283041 . AGAAGACTCGGGGAGGAGCTGAGGTTCTAGTTTGAGGGTCGTGCACCTGGAGAACTGGACAGGAGCTGATGTTCTAGATTGAGCATCGTACAGCTGAAGACTTGGGGAGGAGCTTATGTTGTTCACTTTGAGGGTCTTTCAGCTGGAGACTCAGGCAGGAGCTGATGTTCTAGTTTGAGGATCTCGTAGCTGCAGAATCAGAGAGGAGCTGATGTTCTAGATTGAGGATCTTGTAGCTACAGACCCATAGAGGAGCTGATGATCTAGATTCAGGGTCATGCAGCT A . . AS_SB_TABLE=57,54|8,7;DP=126;ECNT=1;MBQ=30,31;MFRL=358,237;MMQ=60,60;MPOS=15;POPAF=7.30;TLOD=3.22 GT:AD:AF:DP:F1R2:F2R1:FAD:SB 0/1:111,15:0.028:126:17,1:18,5:86,9:57,54,8,7
Expected behavior
Mutect2 should either not emit an invalid variant or it should be able to parse it
Actual behavior
java.lang.ArrayIndexOutOfBoundsException: arraycopy: source index -152 out of bounds for byte[278]
at java.base/java.lang.System.arraycopy(Native Method)
at java.base/java.util.Arrays.copyOfRange(Arrays.java:3823)
at org.broadinstitute.hellbender.tools.walkers.annotator.TandemRepeat.getNumTandemRepeatUnits(TandemRepeat.java:54)
at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.AssemblyRegionTrimmer.trim(AssemblyRegionTrimmer.java:189)
at org.broadinstitute.hellbender.tools.walkers.mutect.Mutect2Engine.callRegion(Mutect2Engine.java:273)
at org.broadinstitute.hellbender.tools.walkers.mutect.Mutect2.apply(Mutect2.java:304)
at org.broadinstitute.hellbender.engine.AssemblyRegionWalker.processReadShard(AssemblyRegionWalker.java:200)
at org.broadinstitute.hellbender.engine.AssemblyRegionWalker.traverse(AssemblyRegionWalker.java:173)
at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1098)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:149)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:198)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:217)
at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:160)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:203)
at org.broadinstitute.hellbender.Main.main(Main.java:289)
The text was updated successfully, but these errors were encountered:
Hi all.
We do have a PR in the master branch to fix this issue. However keep in mind that the variant you are trying to call is probably way above the size that one can call a simple INDEL. #6388
Bug Report
Affected tool(s) or class(es)
Mutect2
Affected version(s)
4.4.0.0
Description
Hello GATK team,
I am working on a pipeline that calls variants using Mutect2 and uses those mutations for somatic variant calling in other samples. To achieve this I'm using the -allele flag in Mutect2 to pass the desired positions to genotype to Mutect2. However it appears that Mutect2 will output variants that it then is unable to parse as an -allele file. I believe this is because the REF column is too long.
Steps to reproduce
Try to variant call using an -allele VCF containing this line:
Expected behavior
Mutect2 should either not emit an invalid variant or it should be able to parse it
Actual behavior
The text was updated successfully, but these errors were encountered: