| Tag | Type | Description |
|---|---|---|
| EX | Z | Comma (,) separated values for each exons the node is part of. Annotated as [Transcript].[Exon_Number] |
| LN | i | Sequence length |
| NC | i | Count of read that cover the node |
| IL | Z | Comma (,) separated values for counting in-links position over the sequence. Annotated as [Index].[Count] |
| OL | Z | Comma (,) separated values for counting out-links position over the sequence. Annotated as [Index].[Count] |
S 5 AAA LN:i:3 EX:Z:Ttest.1
S 577768 ATTTAT LN:i:6
S 549841 TTCATCTGGTAGTTCTTG LN:i:18 EX:Z:ENST00000284878.4,ENST00000400166.4,ENST00000400165.4,ENST00000400169.4
S 579999 GTCAGGTCATGTGAAAGCTTAC LN:i:22 IL:Z:0.256,20.2 OL:Z:22.272,20.3,3.1,19.4,17.1,11.1,4.1,8.1
| Tag | Type | Description |
|---|---|---|
| JN | Z | Comma (,) separated values for each junction between exons. Annotated as [Transcript].[Exon_From].[Exon_To] |
| RC | i | Count of read that cover the link |
| ID | Z | Tag N to identify a novel link |
L 15 + 16 + 0M JN:Z:Ttest.2.3
L 548094 + 548095 + 0M
L 580290 + 580291 + 0M JN:Z:ENST00000284885.6.7,ENST00000422787.7.8,ENST00000474775.3.4
L 548097 + 548099 + 0M RC:i:10 ID:Z:N